GC69287
IONIS-MAPTRx
IONIS-MAPTRx (BIIB080) is the first antisense oligonucleotide (ASO) that lowers Tau· IONIS-MAPTRx has the potential to study Alzheimer's disease· (IONIS-MAPTRx used in mice: TauASO-12 sequence - 5' GCTTTTACTGACCATGCGAG 3')
ChemicalCAS2857842-32-9MW7182
- CAS number
- 2857842-32-9
- Molecular weight
- 7182
- Formula
- —
- Solubility
- H2O ： 50 mg/mL (6·96 mM; Need ultrasonic)
- Catalogue number
- GC69287
- Brand
- GLPBIO
Ordering in Israel
- Lead time
- Ships from the manufacturer to your lab in 8–14 business days; customs and cold chain handled by LABO Scientific.
- Pricing
- Quoted in ILS, excl. VAT. Add the item to your quote and we confirm the final price, usually the same business day.
- Documents
- Lot certificate of analysis and manufacturer SDS are emailed with your order confirmation.
- Who we serve
- Universities, hospitals and biotech companies across Israel. Research use only — not for diagnostic or therapeutic use.
- Questions
- WhatsApp · +972-55-990-7576 · orders@labo.co.il